BiolRes 39: 641-648, 2006

ARTICLES

Cloning and functional characterization of the gene encoding the transcription factor Acel in the basidiomycete Phanerochaete chrysosporium

RUBÉN POLANCO^1#, PAULO CANESSA¹, ALEXIS RIVAS¹, LUIS F. LARRONDO¹, SERGIO LOBOS² and RAFAEL VICUÑA^1*.

¹Departamento de Genética Molecular y Microbiología, Facultad de Ciencias Biológicas, Pontificia Universidad Católica de Chile and Millenium Institute for Fundamental and Applied Biology, Santiago, Chile. 2Laboratorio de Bioquímica General, Departamento de Bioquímica y Biología Molecular, Facultad de Ciencias Químicas y Farmacéuticas, Universidad de Chile, Santiago, Chile.
^1# Present address: Departamento de Ciencias Biológicas, Facultad de Ciencias de la Salud, Universidad Andrés Bello. Av. República 217, Santiago, Chile.

Dirección para correspondencia

ABSTRACT

In this report we describe the isolation and characterization of a gene encoding the transcription factor Acel (Activation protein of cup 1 Expression) in the white rot fungus Phanerochaete chrysosporium. Pc-acel encodes a predicted protein of 633 amino acids containing the copper-fist DNA binding domain typically found in fungal transcription factors such as Acel, Macl and Haal from Saccharomyces cerevisiae. The Pc-acel gene is localized in Scaffold 5, between coordinates 220841 and 222983. A S. cerevisiae acel null mutant strain unable to grow in high-copper medium was fully complemented by transformation with the cDNA of Pc-acel. Moreover, Northern blot hybridization studies indicated that Pc-acel cDNA restores copper inducibility of the yeast cup 1 gene, which encodes the metal-binding protein metallothionein implicated in copper resistance. To our knowledge, this is first report describing an Acel transcription factor in basidiomycetes.

Key terms: Acel, basidiomycete, copper, Phanerochaete chrysosporium.

INTRODUCTION

A small group of filamentous fungi, collectively known as white-rot fungi, has the unique ability to breakdown lignin, a highly recalcitrant polymer present in the plant cell walls. Lignin-degrading fungi secrete an array of oxidative extracellular enzymes including lignin peroxidase (LiP), manganese peroxidase (MnP) and a copper-containing phenol oxidase called lacease (Gold and Alie, 1993; Cullen and Kersten, 2004). All these enzymes act nonspecifically through the generation of lignin free radicals, which undergo spontaneous cleavage reactions (Kirk and Farrell, 1987).

Althoug the involvement of loccase in ligninolysys has been well established (Eggert et al., 1997), some white rot fungi (i.e.Phanerochaete chrysosporium) do not produce this enzyme, suggesting that it may not be absolutely required for lignin degradation (Hatakka, 1994). Laccases belong to the large family of multicopper oxidase (MOCs) thar also includes plant ascorbate oxidase, fungal Fet3 ferroxidases and mammalian ceruloplasmin, among other proteins (Solomon et al., 1996). A combination of details spectroscopic and X-ray crystallographic studies has revealed that all these enzymes contain at least one blue copper ot T1 site and a type 2 - type 3 (T2/T3) trinuclear copper cluster as the minimal functional unit (Baldrian, 2006; Solomon et al., 1996). These copper centers, located in the active site of these enzymes, play a key role in catalysis. On the other hand, this metal also exerts an effect at the transcriptional level, as shown mainly with laceases. Thus, copper regulates transcription of lacease genes in Trametes versicolor (Collins and Dobson, 1997), Ceriporiopsis subvermispora (Karahanian et al., 1998), Pleurotus ostreatus (Palmieri et al., 2000), Pleurotus sajor-caju (Soden and Dobson, 2001; Soden and Dobson, 2003) and Trametes pubescens (Galhaup et al., 2002). Since dozens of closely related lacease genes have been characterized in lignin-degrading fungi (Kumar et al., 2003), it is highly likely that their regulation by copper could be a widespread phenomenon.

Little is known about the mechanism by which this metal activates lacease gene expression in basidiomycetes. Several transcription factors responding to copper, such as Acel, Macl, Cufl and Amtl, have been identified in Ascomycetes (Jungmann et al., 1993; Labbe et al., 1999; Thiele, 1988; Zhou and Thiele, 1991). However, there is no evidence that any of these transcription factors are present in basidiomycetes. Interestingly, putative Acel transcription factor-binding sites have been identified in the promoter region of the lacease genes in the basidiomycete PM1 (Coll et al., 1993), C. subvermispora (Karahanian et al., 1998) and P. sajor-caju (Soden and Dobson, 2003). This element was first described in the promoter regions of the cup 1 (Thiele, 1988) and sodl (Gralla et al., 1991) genes, which encode metallothionein and a copper-zinc superoxide dismutase in yeast, respectively. The S. cerevisiae Acel transcription factor binds its recognition sequence and activates the transcription of target genes in response to copper or silver, but not to zinc (Furst et al., 1988).

The fact that the lacease gene from C. subvermispora (Cs-lcs) is also activated by silver but not by zinc (Karahanian et al., 1998) prompted us to identify and isolate the Acel transcription factor in this fungus. We initially followed the strategy of identifying the protein by means of electrophoretic mobility-shift assays (EMSA), using a 95 bp DNA probe containing the Cs-lcs ACE-like element (Polanco et al., 2002). Although specific complexes were formed upon incubation of this DNA probe with crude nuclear extracts, attempts to isolate the Acel factor were unsuccessful. Taking a different approach, we used the publicly available information in the genome database of P. chrysosporium (http://genome.jgi-psf.org/ Phchrl/Phchrl.home.html), the first basidiomycete whose genome has been sequenced, to find out whether this fungus has a gene encoding for Acel. In this work we report the finding of a presumed gene model and the subsequent confirmation of its identity by cDNA cloning, sequencing and complementation of a S. cerevisiae acel null mutant strain.

METHODS

Strains, plasmids and culture conditions

P. chrysosporium homokaryotic strain RP-78 was obtained from the Center for Mycology Research, Forest Products Laboratory, Madison, Wisconsin. P. chrysosporium spores were collected by flooding the agar plates with 5 ml of sterile water. 10⁷ spores were inoculated in 100 ml of defined media containing wood-derived crystalline cellulose (Avicel PH-101, Fluka Chemika) as the sole carbon source, as described by Wymelenberg et al. (2002). Cultures were incubated at 37 °C for 6 days with constant agitation (300 R.P.M.). Saccharomyces cerevisiae DTY7 strain (MATα, his6, leu-, ura3-52, CUP1 R-3), DTY59 strain (MATα, his6, leu-, ura3-52, CUP1 R-3, acel-Δ225) and the plasmid p416GPD were kindly provided by Dr. D. J. Thiele (Duke University Medical School). These strains were maintained on YPD plates. DTY7 and DTY59 transformants were maintained on SC URA(-) plates (Sherman, 2002) at 30 °C not supplemented with copper. For Northern blot analysis and metal resistance test experiments, each transformant was grown on SC URA(-) liquid cultures at 30 °C with constant agitation (200 R.P.M.). These cultures contained different concentrations of CuS0₄ as indicated in each experiment (see below). Bacterial strain DH5oc (Stratagene) was used for the propagation of all plasmids. pGEM-T easy vector (Promega) was used for cloning experiments and sequencing.

RNA extraction

After six days of growth, P. chrysosporium mycelia were separated from the culture fluids by filtration through Miracloth (Calbiochem) and immediately frozen in liquid nitrogen. The frozen mycelia were ground to a powder in a mortar containing liquid nitrogen and total RNA was extracted as described by Manubens et al. (2003). Poly(A) mRNA was obtained from 100 \ig of total RNA using the mRNA DIRECT micro kit (Dynal) according to the manufacturer's directions. For S. cerevisiae total RNA extraction, 20 ml cultures of each transformant were grown in 250 ml flasks as described above until reaching an OD₆₀₀ = 1.0. Cultures were either harvested or exposed to CuS0₄ to a final concentration of 250 mM for 45 minutes. Each flask was pelleted in a 50 ml size RNase-free phenol-resistant centrifuge tube. Pellets were washed with 2 ml of DEPC-treated water and pelleted again. Thereafter, pellets were vortex-homogenized in the same tube by the addition of 0.7 ml Tris-HCl buffer (0.2M Tris-HCl pH 7.5, 0.5M NaCl, 0.01M EDTA, 1 % SDS, 50mM ß3-mercaptoethanol), 0.7 ml of phenol:cloroform:isoamyl alcohol (25:24:1) and 0.4 gr of acid-washed glass beads. After centrifugation, the aqueous phase was phenol-extracted in a clean tube and the RNA was obtained as described by Manubens etal. (2003).

Pc-acel cDNA identification, cloning and analysis

Pc-acel cDNA was obtained by reverse transcription using poly(A) mRNA and the Moloney murine leukemia virus reverse transcriptase (Invitrogen) for 45 min at 42 °C. RT-PCR was conducted as described by Larrondo et al. (2003) using high fidelity DNA polymerase (Pfu, Stratagene). The RT-PCR amplification of the Pc-acel cDNA was primed using the direct (5'-GTCATATCCAGCCATGGT-3') and reverse (5'- AGATTAGAATATCCGTGGAC -3') ohgonucleotides. Both primers were designed to amplify the entire predicted coding region according to the genomic sequence. The RT-PCR product was subsequently cloned into the pGEM-T easy vector and nucleotide sequences were determined using the ABI Prism Big Dye terminator cycle sequencing kit on ABI automated sequencers (Applied Biosystems). The Pc-acel cDNA was subcloned into the BamHI site of the p416GPD vector. Electrocompetent DTY7 and DTY59 cells were prepared as described by Becker and Guarente (1991). Both strains were transformed by electroporation with the empty p416GPD vector and with the vector containing the Pc-acel cDNA (p416GPD-Pc-acel) using a MicroPulser apparatus (Biorad) according to the manufacturer's instructions. The four transformants were denoted as DTY7-p416GPD, DYT7-p416GPD-Pc-acel, DTY59-p416GPD and DYT59-P416GPD-PC-acel. Sequence editing and analysis employed DNAstar software (DNAstar). The Pc-acel cDNA sequence had been deposited in the GenBank database under accession number DQ517293.

Northern-blot hybridization

For Northern blot hybridization studies, 10 ug of S. cerevisiae total RNA were fractionated by electrophoresis in a formaldehyde-agarose gel (1.2 % w/v) and blotted onto Hybond-membranes. Blots were prehybridised at 42 °C during 4h in a high stringency solution containing 50% formamide, 1% sodium dodecyl sulphate (SDS), 5X SSPE (Ambion Inc., Austin, TX), 5X Denhardt's solution and 100 µg/ml denaturated sheared nonhomologous DNA. Northern hybridization was carried out at 42 °C for 12 - 14h in the same solution containing 1 x 10⁷ cpm/ml of [α-³²P] dCTP-labelled cDNA probe prepared with the direct (5'-TCAATCATCACATAAAATGTTC-3') and reverse (5' -CGTTTCATTTCCCAGAGCAG-3') oligonucleotides for cup 1. After hybridization, blots were washed in a 2X SSPE 1% SDS solution for 20 min at 42°C and then washed again in a 0.1X SSPE 1% SDS solution for 10 min at 42°C. Blots were exposed on scientific autoradiographic imaging film (Kodak) at -80°C for 24h. As a control, levels of mRNA from the glyceraldehyde-3-phosphate dehydrogenase gene (tdh3) were also monitored using cDNA probes generated with the direct (5'-CCAAGAAAGAGACCCAGC-3') and reverse (5'-CGGTTGGGACTCTGAAAG-3') specific oligonucleotides. All cDNA probes were prepared by PCR using [α-³²P] dCTP as described by Mertz and Rashtchian (1994).

Metal resistance test

To evaluate copper resistance, two different clones of each transformant were tested. Each experiment is expressed as the minimal inhibitory concentration (MIC). The copper-resistance test was conducted using tubes containing SC URA(-) broth either without or with CuS0₄ in a range between 50 to 1500 µM. The tubes were inoculated with 0.1 ml of each S. cerevisiae clone grown to an OD₆₀₀ = 0.9-1.0, and then incubated 72h at 30 °C with constant agitation (200 R.P.M.) in the presence of different copper concentrations. Following incubation, visual turbidity was noted and the OD₆₀₀ was measured and recorded. The MIC was defined as the lowest concentration of copper tested at which no growth was observed after a 72h incubation period.

Genome-wide in silico search of possible Acel transcription factor-binding sites

In an attempt to identify potential Pc-acel target genes, we inspected the Gene Ontology database (http://www.geneontology.org) in order to uncover all the Gene Ontology identification numbers or IDs related to copper-associated molecular functions, biological processes and cellular components. The IDs obtained were used for a Gene Ontology search in the P. chrysosporium database (http://shake.jgipsf.org/cgibin/ToGo?species=Phchrl). Using this approach, 25 gene models that exhibited a copper-

associated biological function were identified and their promoter regions were manually obtained. These promoter sequences were finally analyzed for the presence of regulatory motifs using the Matlnspector software (http://www.genomatix.de).

Multiple-sequence analysis

A multiple-sequence alignment was constructed by using the ClustalW method in the MegAlign software (DNAstar). Default gap opening and extension penalties were used to construct the alignment.

RESULTS AND DISCUSSION

Identification and characterization of Pc-acel

The P. chrysosporium database was searched for the presence of a gene encoding a putative Acel transcription factor. Three gene models were identified in this genome. They are located in Scaffold 25 (between coordinates 30283 and 30513; protein ID 130363), Scaffold 7 (between coordinates 1969672 and 1970136; protein ID 136848) and Scaffold 5 (between coordinates 220893 and 221217; protein ID 131179). The later gene model showed the highest similarity to the S. cerevisiae acel and therefore it was further characterized. Its identity was confirmed by isolation and sequencing of the corresponding cDNA from mycelia grown in Avicel medium, as described in Methods. Comparison of the cDNA with the genomic sequence showed the presence of 4 introns (Figure 1A), the first exon being just 3 nucleotides long. The deduced protein has 633 aa and according to InterProScan (www.ebi.ac.uk/InterProScan/) it possesses a copper-fist DNA-binding domain (IPR001083) comprising residues 1 through 39 of the N-terminal (Figure IB). As expected, a manual inspection of the copper-fist domain signature led to the identification of a conserved array of zinc-binding residues (C-X2-C-X8-C-X-H, CETCIKGHRSSNCKH in Pc-acel, as shown in Figure IB). Interestingly, the codon for the first Cys in the conserved zinc-binding path is split by intron two (Figure IB). A multiple aminoacidic general alignment was conducted with several well-characterized Acel related sequences present in NCBI (BLOSUM 62) using ClustalW. Pc-acel encodes a polypeptide with an overall identity of about 10 % to other fungal Acel-like transcription factors. The highest similarities resulted with the Haal from S. cerevisiae (15.3 %) and with the Crfl protein from Yarrowia lipolytica (12.8 %) (data not shown). In spite of this low identity, the alignment also revealed that the copper-fist DNA-binding domain of Pc-acel possesses a high degree of identity with those of other Acel-like transcription factors. For example, the copper-fist DNA-binding domain of Pc-acel shows 59.0, 48.7 and 51.3 % identity with the equivalent domains of S. cerevisiae Acel, S. cerevisiae Macl and Candida glabrata Amtl transcription factors, respectively (data not shown).

Figure 1: (A) Intron-exon composition of the gene encoding Acel in Phanerochaete chrysosporium. Pc-acel was localized in Scaffold 5 between coordinates 220841 and 222983, as shown in the figure. (B) Representation of the N-terminal half of Pc-acel that contains the copper-fist DNA-binding domain signature (M - [LIVMF](3) - x(3) - [KN] - [MY] - A - C - x(2) - C - µL] - [KR] - x - H - [KR] - x(3) - C - x - H - x(8) - [KR] - x - [KR] - G - R - P), which comprises three-13 residues long motifs. The partial alignment shows the conserved residues (white letters in black boxes) among all the transcription factors analyzed (GenBank access numbers are given in brackets). Phanerochaete chrysosporium Acel (Pc-acel) [ABF60559], Saccharomyces cerevisiae Acel (Sc-Acel) [NP_011349], Saccharomyces cerevisiae Macl (Sc-Macl) [AAT92953], Candida glabrata Amtl (Cg-Amtl) [XP_447430], Schizosaccharomyces pombe Cufl (Sp-Cufl) [CAA90469], Yarrowia lipolytica Crfl (Yl-Crfl) [XP_500631], Saccharomyces cerevisiae Haal (Sc-Haal) [AAT92823] and Podospora anserina Macl homolog (Pa-GRISEA) [CAA61598]. Exons are indicated in black boxes while introns are denoted in white boxes.

Pc-acel encodes a functional transcription factor

Due to the role of Acel in the activation of transcription of the cup 1 in response to copper in S. cerevisiae, the acel Δ strain is unable to grow in copper-rich medium (Thiele, 1988). This observation was the basis for our complementation experiments addressed to the confirmation that Pc-acel indeed encodes a functional transcription factor. S. cerevisiae DTY59 acel Δ strain and the isogenic DTY7 wild-type strain were transformed with either p416GPD or p416GPD-Pc-acel plasmids. Cells were plated on SC plates lacking uridine so that only transformants bearing a plasmid would be able to grow. Plasmid-rescue experiments were performed with some of the colonies in order to confirm successful transformation. All four transformants were able to grow on SC URA(-) plates not supplemented with copper sulfate (data not shown). As expected, the wild-type DTY7 strain but not the acel Δ strain proliferated in SC URA(-) liquid medium in the presence of copper. As described in Methods, two different clones of each transformant were exposed to different concentrations of this metal. As shown in Figure 2, addition of CuS0₄ to a final concentration of 50 µM led to a dramatic decrease of culture growth of only the DTY59 mutant strain. The lack of growth of the S. cerevisiae null mutant was fully compensated by transformation with Pc-acel. DYT59-p416GPD-Pc-acel transformants behaved very similar to the wild-type strain, being able to grow in the same copper concentrations as transformants DTY7-p416GPD or DTY7-P416GPD-Pc-acel. A fivefold increment of the MIC for copper of DTY59 acel Δ strain (MIC≤200 µM) was observed after complementation with Pc-acel cDNA. The MIC showed by DTY59-p416GPD-Pc-acel strain was above 1000 µM, similar to that observed with transformants DTY7-p416GPD and DTY7-p416GPD-Pc-acel.

Figure 2: Copper resistance test. Two different clones of each transformant were grown on SC URA(-) liquid cultures not supplemented with copper until reaching an OD600 = 0.9-1.0, as described in Methods. A separate set of SC URA(-) containing tubes supplemented with different concentrations of copper was inoculated with the S. cerevisiae transformants. Cultures were incubated 72h at 30 °C with constant agitation (200 R.P.M.) and thereafter OD600 was measured. Values represent the mean of two independent cultures ± standard deviation.

cup 1 mRNA levels in S. cerevisiae

To gain insight into the molecular mechanism that accounts for the phenotypes described above, the levels of cup 1 mRNA in the various yeast strains were analyzed by Northern blot hybridization experiments. As shown in Figure 3, the cup 1 transcripts were virtually undetected in cultures of DTY7 andDTY59 (acel Δ ) strains lacking exogenously added copper (Figure 3, lanes 1 to 4). As expected, addition of Cu²⁺ to a final concentration of 250 µM resulted in a dramatic increase in cup 1 mRNA levels in the DTY7 wild-type strain (Figure 3, lanes 5 & 6) but not in the S. cerevisiae DTY59 strain (Figure 3, lane 7). Notably, Pc-acel cDNA restores copper inducibility of cup 1 expression in the latter strain (Figure 3, lane 8). These results strongly support the assertion that Pc-acel is an ortholog of the gene encoding transcription factor Acel in yeast.

Figure 3: cup 1 mRNA levels in the wild type (DTY7) and the acel Δ strain (DTY59). Representative clones of each strain were grown in SC URA(-) medium. Exponential phase cultures (OD600= 0.9-1.0) were harvested (lanes 1 to 4) or exposed to 250 µM CuS04 for 45 min (lanes 5 to 8), as described in Methods. Total RNA was extracted and subjected to Northern blot hybridization.

Possible target genes of transcription factor Pc-acel

The isolation of the cDNA encoding Acel in P. chrysosporium provides us with the opportunity to use it as a heterologous probe for the identification of the acel encoding sequence in C. subvermispora. This goal, which motivated the work reported here, will be accomplished by thorough screening of the genomic (Karahanian et al., 1998) and cDNA (Lobos et al., 1998) libraries of this fungus that are available in our laboratory. At the same time, it poses the challenge of identifying possible target genes in P. chrysosporium. In this regard, we failed to identify a cup 1-like sequence in the P. chrysosporium genome database and the sod 1-like gene model found seems not to contain an ACE-like regulatory element in its promoter region, according to the Matlnspector software (data not shown). In view of the absence of lacease genes in P. chrysosporium (Larrondo et al., 2003), we used the in silico approach described in Methods in an attempt to identify presumed Pc-acel target genes in its genome. Even though this strategy only considered those genes that have been previously annotated, and among them, only those gene models with a copper associated biological function, we identified 7 gene models possessing at least one putative ACE regulatory element in their respective upstream regions. Among these are the genes encoding a copper-exporting P-type ATPase, subunit Va of cytochrome c oxidase, a copper amino oxidase and a multicopper oxidase 1 (Pc-Mcol). The latter corresponds to a new member of the multicopper oxidase family that possesses a strong ferroxidase activity (Larrondo et al., 2003). We are currently conducting experiments to confirm whether these genes are regulated by copper.

ACKNOWLEDGMENTS

This work was financed by grant 1030495 from FONDECYT-Chile and by the Millennium Institute for Fundamental and Applied Biology. P. Canessa is a predoctoral fellow supported by CONICYT-Chile. The authors are indebted to Dr. Dennis Thiele for supplying yeast strains DTY7 and DTY59, as well as plasmidp416GPD.

REFERENCES

BALDRIAN P (2006) Fungal laceases - occurrence and properties. FEMS Microbiol Rev 30: 215-242        [ Links ]

BECKER DM, GUARENTE L (1991) High-efficiency transformation of yeast by electroporation. Methods Enzymol 194: 182-187        [ Links ]

COLL P, TABERNERO C, SANTAMARÍA R, PÉREZ P (1993) Characterization and structural analysis of the lacease I gene from the newly isolated ligninolytic basidiomycete PM1 (CECT 2971). Appl Environ Microbiol 59: 4129-4135        [ Links ]

COLLINS PJ, DOBSON ADW (1997) Regulation of lacease gene transcription. Appl Environ Microbiol 63: 3444-3450        [ Links ]

CULLEN D, KERSTEN PJ (2004) Enzymology and molecular biology of lignin degradation. In: BRAMBL R. and MARZLUF GA (eds) The Mycota III; Biochemistry and Molecular Biology. 2^nd ed. Berlin-Heidelberg: Springer-Verlag. pp: 249-273        [ Links ]

EGGERT C, TEMP U, ERIKSSON K (1997) Lacease is essential for lignin degradation by the white-rot fungus Pycnoporus cinnabarinus. FEBS Lett 407: 89-92        [ Links ]

FURST P, HU S, HACKETT R, HAMER D (1988) Copper activates metallothionein gene transcription by altering the conformation of a specific DNA binding protein. Cell 55: 705-717        [ Links ]

GALHAUP C, GOLLER S, PETERBAUER CK, STRAUSS J, HALTRICH D (2002) Characterization of the major lacease isoenzyme from Trametes pubescens and regulation of its synthesis by metal ions. Microbiology 148: 2159-2169        [ Links ]

GOLD MH, ALIC M (1993) Molecular biology of the lignin-degrading basidiomycete Phanerochaete chrysosporium. Microbiol Rev 57: 605-622        [ Links ]

GRALLA E, THIELE D, SILAR P, VALENTINE J (1991) ACE1, a copper-dependent transcription factor, activates expression of the yeast copper, zinc superoxide dismutase gene. PNAS 88: 8558-8562        [ Links ]

HATAKKA A (1994) Lignin-modifying enzymes from selected white-rot fungi: production and role in lignin degradation. FEMS Microbiol Rev 13: 125-135        [ Links ]

JUNGMANN J, REINS HA, LEE J, ROMEO A, HAS SETT R, KOSMAN D, JENTSCH S (1993) MAC1, a nuclear regulatory protein related to Cu-dependent transcription factors is involved in Cu/Fe utilization and stress resistance in yeast. EMBO J 13: 5051-5056        [ Links ]

KARAHANIAN E, CORSINI G, LOBOS S, VICUÑA R (1998) Structure and expression of a lacease gene from the ligninolytic basidiomycete Ceriporiopsis mbvermispora. Biochim Biophys Acta 1443: 65-74        [ Links ]

KIRK TK, FARRELL RL (1987) Enzymatic "combustion": the microbial degradation of lignin. Annu Rev Microbiol 41: 465-505        [ Links ]

KUMAR SV, PHALE PS, DURANI S, WANGIKAR PP (2003) Combined sequence and structure analysis of the fungal lacease family. Biotechnol Bioeng 83: 386-394        [ Links ]

LABBE S, PENA MM, FERNANDES AR, THIELE DJ (1999) A copper-sensing transcription factor regulates iron uptake genes in Schizosaccharomyces pombe. J Biol Chem 51: 36252-36260        [ Links ]

LARRONDO LF, SALAS L, MELÓ F, VICUÑA R, CULLEN D (2003) A novel extracellular multicopper oxidase from Phanerochaete chrysosporium with ferroxidase activity. Appl Environ Microbiol 69: 6257-6263        [ Links ]

LOBOS S, LARRONDO L, SALAS L, KARAHANIAN E, VICUÑA R (1998) Cloning and molecular analysis of a cDNA and the Cs-mnpl gene encoding a manganese peroxidase isoenzyme from the lignin-degrading basidiomycete Ceriporiopsis subvermispora. Gene 206: 185-193        [ Links ]

MANUBENS A, AVILA M, CANESSA P, VICUÑA R (2003) Differential regulation of genes encoding manganese peroxidase (MnP) in the basidiomycete Ceriporiopsis subvermispora. Curr Genet 43: 433-438        [ Links ]

MERTZ L, RASHTCHIAN A (1994) Nucleotide imbalance and polymerase chain reaction: effects on DNA amplification and synthesis of high specific activity radiolabeled DNA probes. Anal Biochem 221: 160-165        [ Links ]

PALMIERI G, GIARDINA P, BIANCO C, FONTANELLA B, SANNI G (2000) Copper induction of lacease isozymes in the ligninolytic fungus Pleurotus ostreatus. Appl Environ Microbiol 66: 920-924        [ Links ]

POLANCO R, LOBOS S, VICUÑA R (2002) Binding of nuclear proteins to the promoter region of the lacease gene Cs-lcsl from the basidiomycete Ceriporiopsis subvermispora. Enzyme Microb Technol 30: 525-528        [ Links ]

SHERMAN F (2002) Getting started with yeast. Methods Enzymol 350: 3-41        [ Links ]

SODEN DM, DOBSON ADW (2001) Differential regulation of lacease gene expression in Pleurotus sajor-caju. Microbiology 147: 1755-1763        [ Links ]

SODEN DM, DOBSON ADW (2003) The use of amplified flanking region-PCR in the isolation of lacease promoter sequences from the edible fungus Pleurotus sajor-caju. J Appl Microbiol 95: 553-562        [ Links ]

SOLOMON EI, SUNDARAM UM, MACHONKIN TE (1996) Multicopper oxidases and oxygenases. Chem Rev 96: 2563-2605        [ Links ]

THIELE DJ (1988) ACE1 regulates expression of the Saccharomyces cerevisiae metallothionein gene. Mol Cel Biol 8: 2745-2752        [ Links ]

WYMELENBERG AV, DENMAN S, DIETRICH D, BASSETT J, YU X, ATALLA R, PREDKI P, RUDSANDER U, TEERI TT, CULLEN D (2002) Transcript analysis of genes encoding a family 61 endoglucanase and a putative membrane-anchored family 9 glycosyl hydrolase from Phanerochaete chrysosporium. Appl Environ Microbiol 68: 5765-5768        [ Links ]

ZHOU PB, THIELE DJ (1991) Isolation of a metal-activated transcription factor gene from Candida glabrata by complementation in Saccharomyces cerevisiae. PNAS 14: 6112-6116        [ Links ]

Correspondence author: Mailing adress: Departamento de Genética Molecular y Microbiología, Facultad de Ciencias Biológiccas, Pontificia Universidad Católica de Chile, Casilla 114-D. Santiago. Chile. Phone: 56-2-6862663; Fax: 56-2-2225515; E-mail: rvicuna@puc.cl

Received: May 24, 2006. Accepted: June 7, 2006